Encoding ASCII in DNA

“Once we start editing DNA on a large scale, we will need to keep track of what we do, revision histories, comment the new genes and add copyright notices.” This is a suggested standard of entering ASCII information into the genome.

Since I’m sure you’re all wondering, Unxmaal is GGGGGCTCGTCAGCTGGCAGGCAGGCTA in DNA.