Monkey war!

Rest easy, my Minions. There is absolutely no evidence linking us to the army of monkeys invading New Delhi.

However, you can all consider Project “Hooting Ghandi” to be a screeching success.

First rule of Project “Hooting Ghandi”:
you do not talk about the monkeys.

Second rule of Project “Hooting Ghandi”:
you do not talk about the monkeys!

Walkers

My assessment of this whole “IT/Ginger” media hoopla is thus:

Kamen has a history of inventing great things that should exist and don’t, not because some thinktank decided that they should be invented, but because they really should exist. Based on everything I’ve read so far (twenty webpages or so), my guess is that Kamen’s come up with a cheap, fuel-efficient, non-polluting, self-stabilizing personal walker.

Censorship

This is an excellent commentary by Patricia Nell Warren regarding the National Academy of Science’s Workshop on Non-Technical Strategies to Protect Youth from Inappropriate Material on the Internet, [pointy-headspeak for Internet Porn Blocking]. It’s important to note that Ms. Warren is almost 65 years old, and has impressive credentials in both law and education. A good comment:

“It amazes me to see parents who support “family values” demanding government censorship on the Net. In other words, their family values have failed, and they can’t control their children, so they expect the government to control the situation for them.”

Encoding ASCII in DNA

“Once we start editing DNA on a large scale, we will need to keep track of what we do, revision histories, comment the new genes and add copyright notices.” This is a suggested standard of entering ASCII information into the genome.

Since I’m sure you’re all wondering, Unxmaal is GGGGGCTCGTCAGCTGGCAGGCAGGCTA in DNA.

Ghetto Scooter

  • Can’t afford one of those pretty new chrome plated machines that all the cool kids are riding?
    • Last dude on the block to get your own gnarly stunt machine?

Sony Being Stupid Again

According to this article, Sony woke up one day and realized they needed an MP3 player that people would actually buy.

The important part lies in one of the last paragraphs:

Nor are MP3 recordings necessarily illegal: “There are hundreds if not thousands of legal MP3s on the `Net,” Ron Boire, [president of Sony Electronics’ Personal Mobile Products company] said.

“Hundreds if not thousands” of legal MP3s? Let me calculate, for a moment. I own about 200 CDs, and I converted them all to about 2400 legal MP3s and keep them on my PC at home. I also have remote access into my home machine, so I can listen to them at work. Since my PC is technically part of the Net, according to Mr Boire I own just about ALL of the MP3s on the Internet. I feel so special.

woops

I honestly didn’t know that Saturday was Heather‘s birthday.

As Milkman Dan would say,

I’d make you a belated cake, Heather, but I’m not sure what I can do with the remaining food in our pantry/fridge, which consists of some Cheese Grits, some Brownie Mix, a can of Split Pea Soup, and some 3-month-old Eggnog. I’ll do my best.

fire bad

My sister just called to tell me that my parents’ house burned down.

They’d just gotten back from a short vacation to New Orleans, and when my stepdad opened the door to the house, he smelled gas. He didn’t feel it was safe to go inside, so they went to a service station and called the gas company. They waited for the gas co rep for an hour, then decided that he might have gone straight to their house, so they went back home. By the time they got home, the roof had blown off the house, and the insides were gutted by fire.